Antibodies Assay Kits Biology Cells cDNA Clia Kits Culture Cells Devices DNA DNA Templates Elisa Kits Enzymes Equipments Exosomes Gels Isotypes Medium & Serums NATtrol Panel Particles PCR Pcr Kits Peptides Reagents Recombinant Proteins Ria Kits RNA Test Kits Vector & Virus Western Blot

National multi-center for the identification of conversion factors

Collaborative nationwide multicenter for the identification of conversion elements from copies/mL to worldwide models/mL for the normalization of HCMV DNA load.

The current multicentric (n = 11 laboratories) research aimed to establish conversion elements from copies/mL to worldwide models (IU)/mL for the normalization of HCMV DNA load utilizing the primary WHO Worldwide Commonplace for HCMV nucleic acid amplification methods and to reinforce interlaboratory settlement of HCMV DNA quantification strategies.
Examine protocols for entire blood and plasma (extraction and amplification) have been carried out to calculate conversion elements from HCMV DNA copy quantity to IU. The best variability was noticed in samples with decrease HCMV concentrations (3.Zero Log10) in each organic matrices. Total, 73.1% (206/282) of entire blood and 82.2% (324/394) of plasma samples analyzed fell inside a suitable variation vary (±0.5 Log10 distinction).
A median of 0.64 (vary 0.21-1.17) was the conversion issue calculated for the HCMV entire blood panel and 0.82 (vary 0.39-2.2) for the HCMV plasma panel.

GRO / KC (CXCL1) Protein

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164

GRO/KC (CXCL1), Rat Recombinant

EUR 370

GRO/KC (CXCL1), Rat Recombinant

EUR 175

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.


RK00196 96 Tests
EUR 521

KC protein (Mouse)

30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881

KC antibody

20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody

KC Antibody

EUR 376

KC Antibody

EUR 392

KC Antibody

EUR 146

KC antibody

70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294

KC Blocking Peptide

33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide

EUR 153

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363


55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CXCL1 protein

30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein

CXCL1 antibody

70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

33054-100ul 100ul
EUR 252

CXCL1 Antibody

43679-100ul 100ul
EUR 252

CXCL1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Cxcl1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA


E21-597 10ug
EUR 343


EF012822 96 Tests
EUR 689

CXCL1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT10178 2 ug
EUR 301

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140

GRO/KC, murine recombinant

EUR 773

GRO/KC, murine recombinant

EUR 3856

GRO/KC, murine recombinant

EUR 256

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95

CXCL1 ELISA Kit (Mouse) (OKAN04583)

OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

CXCL1 ELISA Kit (Mouse) (OKBB00312)

OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

CXCL1 ELISA Kit (Mouse) (OKCD05712)

OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)

OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)

CXCL1 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

Recombinant Human CXCL1

P0207 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

Disulfide-Unit Conjugation Permits Ultrafast Cytosolic Internalization of Antisense DNA and siRNA.

Improvement of intracellular supply strategies for antisense DNA and siRNA is necessary. Beforehand reported strategies utilizing liposomes or receptor-ligands take a number of hours or extra to ship oligonucleotides to the cytoplasm on account of their retention in endosomes.
Oligonucleotides modified with low molecular weight disulfide models at a terminus attain the cytoplasm 10 minutes after administration to cultured cells. This fast cytoplasmic internalization of disulfide-modified oligonucleotides suggests the existence of an uptake pathway aside from endocytosis.
Mechanistic evaluation revealed that the modified oligonucleotides are effectively internalized into the cytoplasm by disulfide alternate reactions with the thiol teams on the mobile floor. This strategy solves a number of essential issues with the at the moment obtainable strategies for enhancing mobile uptake of oligonucleotides and could also be an efficient strategy within the medicinal utility of antisense DNA and siRNA.

Spatial Presentation of Ldl cholesterol Items on a DNA Dice as a Determinant of Membrane Protein-Mimicking Features.

Cells use membrane proteins as gatekeepers to move ions and molecules, catalyze reactions, relay indicators, and work together with different cells. DNA nanostructures with lipidic anchors are promising as membrane protein mimics due to their excessive tunability.
  • Nonetheless, the design options specifying DNA nanostructures’ features in lipid membranes are but to be totally understood. Right here, we present that altering patterns of ldl cholesterol models on a cubic DNA scaffold dramatically modifications its interplay mode with lipid membranes.
  • This leads to easy design guidelines that enable a single DNA nanostructure to breed a number of membrane protein features: peripheral anchoring, nanopore conduct, and conformational switching to disclose membrane-binding models. Strikingly, the DNA-cholesterol cubes represent the primary open-walled DNA nanopores, as solely 1 / 4 of their wall is fabricated from DNA.
  • This practical range can improve our elementary understanding of membrane phenomena and end in sensing, drug supply, and cell manipulation instruments.

EP300-HDAC1-SWI/SNF practical unit defines transcription of some DNA restore enzymes throughout differentiation of human macrophages.

Differentiation of human macrophages predisposes these cells to quite a few duties, i.e. killing invading pathogens, and this entails the necessity for enhanced intracellular defences towards stress, together with circumstances that will improve DNA injury. Our research exhibits that expression of DNA restore enzymes, similar to PARP1, BRCA1 and XRCC1, are activated throughout macrophage improvement by the SWI/SNF chromatin remodelling advanced, which serves as a histone acetylation sensor.
It recognises and displaces epigenetically marked nucleosomes, thereby enabling transcription. Acetylation is managed each in monocytes and macrophages by the co-operation of EP300 and HDAC1 actions. Differentiation modulates the actions of particular person elements of EP300-HDAC1-SWI/SNF practical unit and entails recruitment of PBAF to gene promoters.
In monocytes, histone-deacetylated promoters of repressed PARP1, BRCA1 and XRCC1 reply solely to HDAC inhibition, with a gap of the chromatin construction by BRM, whereas in macrophages each EP300 and HDAC1 contribute to the fine-tuning of nucleosomal acetylation, with HDAC1 remaining energetic and the steadiness of EP300 and HDAC1 actions controlling nucleosome eviction by BRG1-containing SWI/SNF. Since EP300-HDAC1-SWI/SNF operates on the stage of gene promoters characterised concurrently by the presence of E2F binding web site(s) and CpG island(s), this enables cells to regulate PARP1, BRCA1 and XRCC1 transcription to the differentiation mode and to restart cell cycle development.
Thus, mutual interdependence between acetylase and deacetylase actions defines the acetylation-dependent code for regulation of histone density and gene transcription by SWI/SNF, notably on gene promoters of DNA restore enzymes.

anti-PKA R2

YF-PA13990 50 ul
EUR 363
Description: Mouse polyclonal to PKA R2

anti-PKA R2

YF-PA24454 50 ul
EUR 334
Description: Mouse polyclonal to PKA R2

Anti-IL-31 Antibody

A08339-1 100ug/vial
EUR 334

Anti-IL-17B Antibody

A10846-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IL-17B Antibody (IL17B) detection.tested for IHC in Human, Rat.

Anti-IL-6 Antibody

A00102-1 100ug
EUR 432
Description: Rabbit Polyclonal IL-6 Antibody. Validated in Neu, IHC, WB and tested in Human.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-MonoMethylH3R2me1-(R2) antibody

STJ24010 100 µl
EUR 393
Description: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is located separately from the other H3 genes that are in the histone gene cluster on chromosome 6p22-p21.3.

Anti-TNF-R2 antibody

STJ96053 200 µl
EUR 197
Description: Rabbit polyclonal to TNF-R2.

Anti-GABAB R2 antibody

STJ96379 200 µl
EUR 197
Description: Rabbit polyclonal to GABAB R2.

Anti-PKA R2 (6A9)

YF-MA10721 100 ug
EUR 363
Description: Mouse monoclonal to PKA R2

Anti-PKA R2 (3C7)

YF-MA14876 100 ug
EUR 363
Description: Mouse monoclonal to PKA R2

Anti-IL-22/IL22 Antibody

A00963-1 100ug/vial
EUR 294

Anti-IL-3R beta Antibody

A02219-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IL-3R beta Antibody (CSF2RB) detection.tested for WB in Human, Mouse, Rat.

Anti-IL-2/IL2 Antibody

A00387-1 100ug/vial
EUR 294

Anti-IL-8 Monoclonal Antibody

A00423-1 100ul
EUR 397
Description: Mouse Monoclonal Antibody for IL-8 Antibody (CXCL8) detection. Tested with IHC in Human, Mouse, Rat.

Anti-IL-6 Monoclonal Antibody

M00102-1 100ug
EUR 455
Description: Mouse Monoclonal IL-6 Antibody. Validated in Flow Cytometry, WB and tested in Human.

Anti-IL-17A Monoclonal Antibody

M00421-1 100ug
EUR 455
Description: Mouse Monoclonal IL-17A Antibody. Validated in WB and tested in Human.

Rat Anti-Mouse IL-12 p75 Monoclonal antibody, clone R2-9A5

CABT-L4486-1mg 1 mg
EUR 897

Rat Anti-Mouse IL-12 p75 Monoclonal antibody, clone R2-9A5

CABT-L4486-5mg 5 mg
EUR 2405

Anti-Human IL-17F Biotin Conjugated Monoclonal Antibody

B02062-1 100ug
EUR 432
Description: Mouse Monoclonal Human IL-17F Biotin Conjugated Antibody. Validated in IHC, WB and tested in Human.

Anti-IL-32A Antibody Peroxidase Conjugated

A03286-1 100ug
EUR 455
Description: Rabbit Polyclonal IL-32A Antibody Peroxidase Conjugated. Validated in WB and tested in Human.

IL-1 β

E13-003-1 10μg
EUR 213

IL-1 α

E13-029-1 10μg
EUR 213

Anti-GABA(B) R2 Purified

11-551-C100 0.1 mg
EUR 204

IL-1 beta, rat recombinant

P1019-1 1 mg
EUR 7288
Description: Interleukin 1 beta (IL-1?) is a proinflammatory cytokine and is produced by activated macrophages, monocytes, keratinocytes and other epithelial cells. Both IL-1? and IL-1? bind to the same receptor and have similar biological properties.

IL-1beta, human recombinant

P1018-1 1 mg
EUR 5061
Description: Interleukin 1 beta (IL-1?) is a proinflammatory cytokine and is produced by activated macrophages, monocytes, keratinocytes and other epithelial cells

IL-2, human recombinant

P1020-1 1 mg
EUR 1156
Description: Interleukin 2 (IL2) is a secreted cytokine that is important for the proliferation of T and B lymphocytes and is produced by activated CD4+ and CD8+ T cells, gamma ? T cells, B cells, dendritic cells and eosinophils. IL-2 plays a critical role in immune responses against pathogenic infection

IL-3, human recombinant

P1021-1 1 mg
EUR 4017
Description: Interleukin 3 (IL-3) is a pleiotropic cytokine produced by activated T cells, mast cells and eosinophils, and stimulates the proliferation and differentiation of pluripotent hematopoietic stem cells, and committed progenitor cells of the megakaryocyte

IL-7, human recombinant

P1024-1 1 mg
EUR 6940
Description: Interleukin-7 (IL-7) is a potent lymphoid cell growth factor produced by bone marrow and thymic stromal cells, spleen cells and keratinocytes. IL7 stimulates the proliferation of Pre-B, Pro-B and early T cells.

Notoginsenoside R2

HY-N0909 10mg
EUR 463

Notoginsenoside R2

TN028181 20mg Ask for price

Stipuleanoside R2

TBZ1475 unit Ask for price

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

EI2301-1 96 Well Plate
EUR 477

Anti-Phospho-GABAB R2 (Ser783) Antibody

P03830 100ul
EUR 398
Description: Rabbit Polyclonal Phospho-GABAB R2 (Ser783) Antibody. Validated in IF, WB and tested in Mouse, Rat.

Recombinant Rat IL-1 Beta Protein

PROTQ63264-1 10ug
EUR 317
Description: IL-1β is a proinflammatory cytokine produced in a variety of cells including monocytes, tissue macrophages, keratinocytes and other epithelial cells. Both IL-1α and IL-1β binds to the same receptor and has similar if not identical biological properties. These cytokines have a broad range of activities including, stimulation of thymocyte proliferation, by inducing IL-2 release, B-cell maturation and proliferation, mitogenic FGF-like activity and the ability to stimulate the release of prostaglandin and collagenase from synovial cells. However, whereas IL-1β is a secreted cytokine, IL-1α is predominantly a cell-associated cytokine. Recombinant rat IL-1β is a 17.4 kDa protein containing 153 amino acid residues.

Canine IL-1 alpha Recombinant Protein

R01144-1 5ug/vial
EUR 259
Description: IL-1 alpha (IL-1α, IL-1F1) is a member of the interleukin 1 family of cytokines. IL-1 alpha is an inflammatory cytokine active in the initiation of the inflammatory reaction and in driving Th1 and Th17 inflammatory responses. Canine IL-1 alpha Recombinant Protein is purified interleukin-1 alpha cytokine produced in yeast.

Canine IL-1 beta Recombinant Protein

R00101-1 5ug/vial
EUR 259
Description: IL-1 beta (IL-1β) is a member of the interleukin 1 family of cytokines. The IL-1 beta cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. Canine IL-1 beta Recombinant Protein is purified interleukin-1 beta cytokine produced in yeast.

IL-1-beta Interleukin-1 betaHuman Recombinant Protein

PROTP01584-1 Regular: 10ug
EUR 317
Description: Interleukin-1 beta Human Recombinant produced in E.Coli is a non-glycosylated, Polypeptide chain containing 153 amino acids and having a molecular mass of 17000 Dalton.;The IL-1b is purified by proprietary chromatographic techniques.

IL-1-alpha Interleukin-1 alpha Human Recombinant Protein, His Tag

PROTP01583-1 Regular: 20ug
EUR 317
Description: IL-1A Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 159 amino acids fragment (113-271) with an amino-terminal hexahistidine tag and having a total molecular mass of 22.5kDa. ;The Interleukin-1 alpha His-tag is purified by proprietary chromatographic techniques.

IL-10, human recombinant protein

P1028-1 1 mg
EUR 6731
Description: Interleukin-10 (IL-10) is an immunosuppressive cytokine produced by macrophages, monocytes, T cells, B cells and keratinocytes. IL-10 inhibits the synthesis of proinflammatory cytokines such as IL-1 and TNF-? and proliferation of T cells

IL-15, human recombinant protein

P1029-1 1 mg
EUR 5339
Description: Interleukin 15 (IL-15) is an immunomodulating cytokine mainly produced by adherent peripheral blood mononuclear cells, fibroblasts and epithelial cells and stimulates the proliferation of T lymphocytes.

IL-17A, human recombinant protein

P1030-1 1 mg
EUR 4156
Description: Interleukin-17A (IL-17A) is a proinflammatory cytokine produced by Th17 cells. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases and stimulates the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as the production of nitric oxide (NO).

IL-18, human recombinant protein

P1032-.1 100 µg
EUR 780
Description: Interleukin-18 (IL-18) is a proinflammatory cytokine produced by monocyte/macrophages, osteoblasts and keratinocytes, as a proprotein which is proteolytically processed to its active form by caspase-1. Human IL-18 can enhance NK cell activity in PBMC cultures.

IL-18, human recombinant protein

P1032-1 1 mg
EUR 5061
Description: Interleukin-18 (IL-18) is a proinflammatory cytokine produced by monocyte/macrophages, osteoblasts and keratinocytes, as a proprotein which is proteolytically processed to its active form by caspase-1. Human IL-18 can enhance NK cell activity in PBMC cultures.

IL-21, human recombinant protein

P1033-1 1 mg
EUR 6522
Description: Interleukin-21 (IL-21) is a pleiotropic cytokine produced by CD4+ T cells in response to antigenic stimulation. IL-21 induces the differentiation of T-cell-stimulated B-cells into plasma cells and memory B-cells, apoptotic effects in naïve B-cells.

Recombinant Human IL-24 Protein

PROTQ13007-1 20ug
EUR 317
Description: IL-24 is a secreted glycoprotein belonging to the IL-10 structural family of cytokines. It is produced by a variety of cell types, including B cells, CD4+ cells, NK cells, lymph node DCs, monocytes, and melanoma cells. IL-24 can signal through the IL20R1/IL20R2 and IL22R1/IL20R2 receptors to initiate a signaling cascade which includes the induction of JAK1/STAT3 phosphorylation. IL-24 is, functionally, a pleiotropic protein but is generally characterized as an anti-cancer cytokine that can selectively inhibit growth of a wide variety of human cancer cells through activities that include the induction of differentiation and apoptosis, and the suppression of angiogenesis and cell proliferation. Recombinant human IL-24 is an 18.9 kDa glycoprotein, containing 161 amino acid residues, including a C-terminal His-tag.

Recombinant Human IL-31 Protein

PROTQ6EBC2-1 10ug
EUR 317
Description: Human IL-31 is a T-cell derived cytokine that shares several structural and functional characteristics with IL-6, Oncostatin M, LIF, and Cardiotrophin-1. It signals through a receptor complex comprised of GPL (GP130-like, IL-31RA) and OSMR (Oncostatin M receptor). GPL/OSMR signaling is a strong activator of STAT3 and STAT5, and can also activate STAT1, Jak1, and Jak2 signaling pathways. IL-31 regulated immune responses have been implicated in skin physiology and inflammatory skin diseases. Recombinant IL-31 is a 15.8 kDa protein containing 141 amino acid residues.

Recombinant Human IL-17D Protein

PROTQ8TAD2-1 25ug
EUR 317
Description: IL-17D is a disulfide-linked homodimer of two 185 amino acid polypeptide chains. It belongs to the IL-17 family of structurally-related cytokines that share a highly conserved C-terminal region but differ from one another in their N-terminal regions and in their distinct biological roles. The six known members of this family, IL-17A through IL-17F, are secreted as homodimers. IL-17D has the ability to stimulate the production of IL-6, IL-8, and GM-CSF and inhibits hemopoiesis of myeloid progenitor cells in colony forming assays. Recombinant human IL-17D is a 40.5 kDa disulfide-linked homodimer of two 185 amino acid polypeptide chains.

Recombinant Human IL-22 Protein

PROTQ9GZX6-1 10ug
EUR 317
Description: IL-22 is a member of the IL-10 family of regulatory cytokines which includes IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26. Members of this family share partial homology in their amino acid sequences, but they are dissimilar in their biological functions. Produced by T lymphocytes, IL-22 inhibits IL-4 production by Th2 cells, and induces acute phase reactants in the liver and pancreas. IL-22 signals through a receptor system consisting of IL-10R-β/CRF2-4 and IL-22R, both of which are members of the class II cytokine-receptor family. Recombinant human IL-22 is a 33.6 kDa non-disulfide-linked homodimeric protein containing of two 146 amino acid polypeptide chains.

Recombinant Human IL-17E Protein

PROTQ9H293-1 25ug
EUR 317
Description: IL-17E is a disulfide-linked homodimer of two 145 amino acid polypeptide chains. It belongs to the IL-17 family of structurally-related cytokines that share a highly conserved C-terminal region, but differ from one another in their N-terminal regions and in their distinct biological roles. The six known members of this family, IL-17A through IL-17F, are secreted as homodimers. IL-17E stimulated secretion of IL-8, and induces activation of the transcription factor NF-κB in cells that express the IL-17BR receptor. Recombinant human IL-17E is a 33.8 kDa disulfide-linked homodimer of two 145 amino acid polypeptide chains.

Recombinant Human IL-20 Protein

PROTQ9NYY1-1 10ug
EUR 317
Description: IL-20 is a member of the IL-10 family of regulatory cytokines which includes IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26. Members of this family share partial homology in their amino acid sequences but they are dissimilar in their biological functions. IL-20 is a hematopoietic growth factor capable of stimulating colony formation by CD34+ multipotential progenitors, but not by other progenitor cells. IL-20 signals through a receptor system composed of type I IL-20R-α and type II IL-20R-β. Over-expression of IL-20 in keratinocytes expressing both receptor subunits has been implicated in the induction of inflammatory skin disease. Recombinant human IL-20 is a 35.2 kDa homodimeric protein consisting of two 153 amino acid polypeptide chains.

Recombinant Human IL-19 Protein

PROTQ9UHD0-1 10ug
EUR 317
Description: IL-19 belongs to the IL-10 family of regulatory cytokines which includes IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26. Members of this family share partial homology in their amino acid sequences but they are dissimilar in their biological functions. Preliminary data suggests that IL-19 is a proinflammatory cytokine because it up-regulates IL-6 and TNF-α and induces apoptosis through TNF-α. IL-19 signals through the type I IL-20R. Human and murine IL-19 share 71% amino acid sequence identity. Recombinant human IL-19 is a 17.9 kDa protein containing 153 amino acid residues. In solution IL-19 exists predominantly as a non-disulfide-linked dimer.

Recombinant Human IL-12 Protein

PROTP29459-1 10ug
EUR 317
Description: IL-12 is a potent regulator of cell mediated immune responses and it induces IFN-γ production by NK and T cells. It is produced by activated monocytes/macrophage cells, B lymphocytes and connective tissue type mast cells. Among its biological activities IL-12 promotes the growth and activity of activated NK, CD4+ and CD8+ cells and induces the development of IFN-γ producing Th1 cells. Recombinant Human IL-12 is a 75.0 kDa heterodimeric glycoprotein consisting of disulfide-linked 35 kDa (p35) and 40 kDa (p40) subunits (503 total amino acid residues).

Recombinant Murine IL-17 (IL-17A) Protein

PROTQ62386-1 25ug
EUR 317
Description: The originally described IL-17 protein, now known as IL-17A, is a disulfide linked homodimer, secreted by activated T-cells that act on stromal cells to induce production of proinflammatory and hematopoietic bioactive molecules. Today, IL-17 represents a family of structurally-related cytokines that share a highly conserved C-terminal region but differ from one another in their N-terminal regions and in their distinct biological roles. The six known members of this family, IL-17A through IL-17F, are secreted as homodimers. IL-17A exhibits cross-species bioactivity between human and murine cells. Recombinant murine IL-17A is a 30.0 kDa disulfide-linked homodimer of two 133 amino acid polypeptide chains.

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Anti-GABAB Receptor (Ser783), R2-Subunit antibody

STJ120094 100 µl
EUR 526

IL-8 (77 a.a.), human recombinant

P1026-1 1 mg
EUR 4226
Description: Interleukin-8 (IL-8) is a proinflammatory CXC chemokine produced by macrophages, epithelial cells. IL-8 is also synthesized by endothelial cells, which store IL-8 in their storage vesicles, the Weibel-Palade bodies

TNF-R2 Antibody

AF0364 200ul
EUR 304
Description: TNF-R2 antibody detects endogenous levels of total TNF-R2.

TNF-R2 Antibody

AF0365 200ul
EUR 304
Description: TNF-R2 antibody detects endogenous levels of total TNF-R2.

TNF- R2 Antibody

ABF0364 100 ug
EUR 438

TNF- R2 Antibody

ABF0365 100 ug
EUR 438

R-Notoginsenoside R2

N2244-20 20 mg
EUR 572
Description: Extracted from Panax Notoginseng dried roots;Store the product in sealed, cool and dry condition

ApoE R2, CF

PR15062CF 50 ug
EUR 461

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EMI2200-1 96 Well Plate
EUR 477

Anti-IL-1 Alpha Antibody

A01144 1mg
EUR 1232
Description: Rabbit Polyclonal IL-1 Alpha Antibody. Validated in WB and tested in Human.

Anti-IL-1 beta Antibody

A00101-2 1mg
EUR 1232
Description: Rabbit Polyclonal IL-1 beta Antibody. Validated in IP, IHC, WB and tested in Human.

anti- IL 1 alpha antibody

FNab04208 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: interleukin 1, alpha
  • Uniprot ID: P01583
  • Gene ID: 3552
  • Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against IL 1 alpha

Anti-IL 1 alpha antibody

PAab04208 100 ug
EUR 386

Anti-IL-1 RII antibody

STJ16100664 100 µg
EUR 742

Anti-IL-1 beta antibody

STJ73078 100 µg
EUR 359

IL-8 Interleukin-8 (1-77 a.a) Human Recombinant Protein (CXCL8)

PROTP10145-1 Regular: 25ug
EUR 317
Description: Interleukin-8 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 77 amino acids and having a molecular mass of 8904 Dalton. ;The IL-8 is purified by proprietary chromatographic techniques.

IL-1RA Interleukin-1 Receptor Antagonist Human Recombinant Protein, His Tag

PROTP18510-1 Regular: 50ug
EUR 682
Description: IL1Ra Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 152 amino acids fragment (26-177) and having a total molecular mass of 21.63kDa with an amino-terminal hexahistidine tag. ;The IL-1Ra His is purified by proprietary chromatographic techniques.


E13-013-1 10μg
EUR 161


E13-015-1 10μg
EUR 161


E13-016-1 10μg
EUR 161

Anti-IL-1F6 / IL-36

PAab04239 100 ug
EUR 412

IL-1-alpha Interleukin-1 alpha Mouse Recombinant Protein, His Tag

PROTP01582-1 Regular: 20ug
EUR 317
Description: IL 1 alpha Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (115-270 a.a) and having a molecular mass of 20.4kDa.;IL 1 alpha is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

IL-1-beta Interleukin-1 beta Mouse Recombinant Protein, His Tag

PROTP10749-1 Regular: 25ug
EUR 317
Description: Interleukin-1 beta Mouse Recombinant produced in E.Coli is a non-glycosylated, Polypeptide chain containing 189 amino acids and having a molecular mass of 21 kDa. ;The IL-1b is fused to His-Tag and purified by proprietary chromatographic techniques.

IL-1-alpha Interleukin-1 alpha Rat Recombinant Protein, His Tag

PROTP16598-1 Regular: 20ug
EUR 317
Description: IL 1 alpha Rat Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (115-270 a.a) and having a molecular mass of 20.2kDa.

IL-17 Interleukin-17 Human Recombinant Protein

PROTQ16552-1 Regular: 25ug
EUR 317
Description: Interleukin-17A Human Recombinant produced in E.Coli is a homodimeric, non-glycosylated polypeptide chain containing a total of 264 amino acids (2 chains of 132 aa) and having a molecular mass of 31kDa.  ;The IL-17 is purified by proprietary chromatographic techniques.

IL-29 Interleukin-29 Human Recombinant Protein

PROTQ8IU54-1 Regular: 20ug
EUR 317
Description: IL-29 human recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 181 amino acids and having a molecular mass of 20 kDa.

IL-28A Interleukin-28A Human Recombinant Protein

PROTQ8IZJ0-1 Regular: 20ug
EUR 317
Description: IL-28A human recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 175 amino acids and having a molecular mass of 19.6 kDa.

IL-17B Interleukin 17B Human Recombinant Protein

PROTQ9UHF5-1 Regular: 25ug
EUR 317
Description: Interleukin-17B Human Recombinant produced in E.Coli is a homodimeric, non-disulfide-linked polypeptide chain containing a total of 322 amino acids (2 chains of 161aa) and having a molecular mass of 36.5kDa. The IL-17B is purified by proprietary chromatographic techniques.

IL-4 Interleukin-4 Human Recombinant Protein

PROTP05112-1 Regular: 20ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 130 amino acids and having a molecular mass of 15kDa. ;The IL-4 is purified by proprietary chromatographic techniques.

IL-6 Interleukin-6 Human Recombinant Protein

PROTP05231-1 Regular: 20ug
EUR 317
Description: Interleukin-6 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 21000 Dalton. ;The IL6 is purified by proprietary chromatographic techniques.

IL-3 Interleukin-3 Human Recombinant Protein

PROTP08700-1 Regular: 10ug
EUR 317
Description: Interleukin-3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 133 amino acids and having a molecular mass of 15000 Dalton. The IL-3 is purified by proprietary chromatographic techniques.